Step 1: Upload Files


Genome Contig Files

Drag & Drop FASTA Genome Files Here
(Max 10 Genomes with 1-10 Contigs Per File)

-or-

Gene Query Files

Drag & Drop FASTA Gene Files Here
(Max 60 Sequences Per File)

-or-

File Upload Status

No files have been uploaded yet.

Associate Genome and Gene Files

No files have been uploaded yet.
Genome1
  • Name:
  
Genome2
  • Name:
  
Genome3
  • Name:
  
Genome4
  • Name:
  
Genome5
  • Name:
  
Genome6
  • Name:
  
Genome7
  • Name:
  
Genome8
  • Name:
  
Genome9
  • Name:
  
Genome10
  • Name:
  
Genome11
  • Name:
  
Genome12
  • Name:
  
Genome13
  • Name:
  
Genome14
  • Name:
  
Genome15
  • Name:
  

Advanced Settings for Gene Matches
  • BLAST E-value Threshold: [0.0001-10]
  • BLAST Alignment Type: Gapped | Ungapped
  • Minimum Query Coverage Cutoff: [1-100] % 

  • Circular Genome Mode: Off | On (Genome1's gene order used to align others) 



Genome File Requirements

Gene File Requirements

Minimum Query Coverage Cutoff

Only query sequences with a percentage of basepairs/residues falling within significant BLAST hits at, or above, this value will appear in your results. Using the full-length gene query sequence, we tile the hits or 'HSPs' (High-scoring Segment Pair) which map with the same strand/direction as the HSP with the highest bitscore. A simplified example is shown below:

Original Query Gene: 1 ACCACCTTGAACAATCC 17
Genome Contig Sequence: 1 AACACCTCTCTCTTAAACTTT 21

BLAST HIT 1:
Query 1 ACCACCT 7
        | |||||
Sbjct 1 AACACCT 7

BLAST HIT 2:
Query 6  CTTGAACAAT 15
         ||| |||  |
Sbjct 12 CTTAAACTTT 21


Now we map the significant hits back to the original:

Original: ACCACCTTGAACAATCC
    Hit1: A-CACCT
    Hit2:      CTT-AAC--T
Combined: ACCACCTTGAACAAT--
Coverage: 15/17 (88.24%)


Note how the gaps within BLAST hits are ignored when calculating the final coverage score. If the 'Minimum Query Coverage Cutoff' was set to 88% this gene would map, however, if it was set to 89% it would not. This feature is included to help avoid queries with only a small fragment mapping to a genome from cluttering up results. Setting the value to '1' will show any query with at least one significant hit in your results.

Circular Genome Mode

This mode can be useful when dealing with circular genomes from bacteria or mitochondria. When using this mode, Genome1 acts as a reference for the order that genes appear. All other genomes will then be rotated to maximize the number of genes which match this order. This mode requires each genome to have only one circular contig and will be disabled if you upload a genome with more than one contig.